• Explorar
      • Comunidades & Colecciones
      • Fecha de Publicación
      • Autores
      • Títulos
      • Tema
    • Acerca del repositorio
      • Contactenos
    • Servicios
    • Login
    View Item 
    •   DSpace Home
    • Tabasco
    • Producción Agroalimentaria en el Trópico
    • Tesis MC, MT, MP y DC
    • View Item
    •   DSpace Home
    • Tabasco
    • Producción Agroalimentaria en el Trópico
    • Tesis MC, MT, MP y DC
    • View Item
    JavaScript is disabled for your browser. Some features of this site may not work without it.

    Selección de patrones de cítricos tolerantes al virus de la tristeza de los cítricos (VTC) con resistencia a la gomosis de los cítricos en la sabana de Huimanguillo, Tabasco

    Thumbnail
    View/Open
    Acosta_Perez_JA_MC_Produccion_Agroalimentaria_Tropico_2008.pdf (5.406Mb)
    Date
    2008
    Author
    Acosta Pérez, Jorge Alberto
    Metadata
    Show full item record
    Abstract
    La gomosis de los cítricos o podredumbre del pie es una enfermedad producida por especies del género Phytophthora. en cultivos de naranja y limón persa en la sabana de Huimanguillo, Tabasco. En el presente estudio se presenta la identificación morfológica y molecular de la especie de Phytophthora causante de la gomosis. De un total de 34 sitios muestreados sistemáticamente se lograron obtener 13 aislamientos de tejidos de tallo y frutos enfermos de branja y limón. Para esto se utilizaron medios de cultivos Zanahoria-Agar 10%-V8 selectivos a base de Rifampicina, Piramicina, Vancomicina, Penicilina, Pentacloronitrobenzeno (PCNB) y Benlate. Las caracterizaciones morfológicas de dichos aislamientos presentaron micelio tuluroso cenocítico, esporangios papilados, clamidosporas intercalares y terminales de pared gruesa y que de acuerdo a las claves morfológicas de Stamps, Watherhause, Newhook y Hall 1990 pertenecen a la especie P. parasitica Dastur [(sin. P. nicotianae Breda de Haan var. parasitica (Dastur) Waterhouse)]. Así mismo, la identificación molecular de las cepas aisladas se baso en la amplificación del gen 18S DNAr. Para esto, las 13 cepas fueron crecidas en medio líquido YEPD. Se extrajo el ADN cromosómico y se amplificó el gen 18S DNAr por PCR empleando los iniciadores: LV1(5’CCTGCCAGTAGTCATATGCTTGTCT3’) y LV2(5’CACCTACGGAAACCTTGTTACGACT3’). Los fragmentos de ADN obtenidos se secuenciaron y fueron analizados con el software Chromas Versión 2.31 (Technelysium Pty Ltd.) y alineados con secuencias depositadas en la base de datos de la NCBI (National Center for Biotechnology Information). Los porcentajes de similitud nucleotídica se calcularon con el programa MEGA versión 2.1 (Kumar y col., 2001). Con los datos del alineamiento múltiple, se construyó un árbol filogenético. La amplificación y secuenciación del gen 18S DNAr, permitió la identificación molecular de los hongos aislados como P. parasitica o P. nicotianae var parasitica). Adicionalmente se puede señalar que con base a las evaluaciones de las 34 fincas visitadas la incidencia de la gomosis es 17.5 % con un rango de variación de 1.4 a 45.0%; siendo los daños mayores en plantaciones de limón Persa que en naranja Valencia. Asimismo, se puede señalar que en las plantaciones de limón Persa, existe una nueva enfermedad con sintomatología externos algo semejante a la gomosis y que los productores equivocadamente están manejándola como tal. Esta enfermedad estuvo presente en las 44 % de las plantaciones de limón Persa con una incidencia promedio de 10.2% y rango de 1.7 a 25.0%. Este es el primer reporte de P. parasitica como agente causal de la gomosis de los cítricos en Tabasco._________The gomosis of the citruses or rottenness of the foot is a disease produced by species of the Phytophthora. in cultures of orange and Persian lemon in the savannah of Huimanguillo, Tabasco. In the present study the morphologic and molecular identification of the species of Phytophthora appears cause of the gomosis. Of a total of 34 sites sampled systematically they were managed to obtain 13 stem ill weave isolations and fruits of orange and lemon. For this means of selective Carrot-Agar cultures were used 10%-V8 with Rifampicin, Piramicin Vancomicin, Penicillin, Pentacloronitrobenzeno (PCNB) and Benlate. The morphologic characterizations of these papilados isolations presented/displayed cenocítico tuluroso mycelium, esporangios, clamidosporas intercalary and terminals of heavy wall and that according to the morphologic keys of Stamps, Watherhause, Newhook and Hall 1990 belong to species P. parasitic Dastur [(without. P. nicotianae Breda de Haan bar. parasitic (Dastur) Waterhouse)]. Also, the molecular identification of the isolate stocks I am based on the amplification of the gene 18S DNAr. For this, the 13 stocks were swellings in the middle liquid YEPD. The chromosomal DNA was extracted and the gene was amplified 18S DNAr by PCR using the initiators: LV1 (5 ' CCTGCCAGTAGTCATATGCTTGTCT3') and LV2 (5 ' CACCTACGGAAACCTTGTTACGACT3'). The obtained DNA fragments were sequenced and were analyzed with software Chromas Version 2.31 (Technelysium Pty Ltd.) and aligned with sequences deposited in the data base of the NCBI (National for Center Biotechnology Information). The percentage of nucleotide similarity calculated with the program MEGA version 2.1 (Kumar and cabbage., 2001). With the data of the multiple alignments, a Phylogenetic tree was constructed. The amplification and sequencing of the gene 18S DNAr, allowed to the molecular identification of the fungi isolated like P.parasitic or P. nicotianae var Parasitica). Additionally it is possible to be indicated that with base to the evaluations of the 34 visited property the incidence of the gomosis is 17,5% with a rank of variation from 1,4 to 45,0%; being the damages majors in plantations of Persian lemon that in Valencia orange. Also, it is possible to be indicated that in the plantations of Persian lemon, something similar to the gomosis exists a new disease with group of symptoms external and that the producers wrongly are handling it like so. This disease was present in 44% of the plantations of Persian lemon with an incidence 10,2% average of and rank from 1,7 to 25,0%. This it is the first report of parasitic P. like causal agent of the gomosis of the citruses in Tabasco.
    URI
    http://hdl.handle.net/10521/1663
    Collections
    • Tesis MC, MT, MP y DC [284]

    DSpace software copyright © 2002-2022  LYRASIS
    Contact Us | Send Feedback
    Theme by 
    Atmire NV
     

     

    Browse
    All of DSpaceCommunities & CollectionsBy Issue DateAuthorsTitlesSubjectsThis CollectionBy Issue DateAuthorsTitlesSubjects

    My Account

    LoginRegister

    DSpace software copyright © 2002-2022  LYRASIS
    Contact Us | Send Feedback
    Theme by 
    Atmire NV